mscv cas9 puro plasmid (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
mscv cas9 puro plasmid
Mscv Cas9 Puro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mscv+cas9+puro+plasmid/MSCV_Cas9_puro+(Plasmid+%2365655)/10__1038_slash_s41375___026___02917___2-243-0-2
Average 94 stars, based on 23 article reviews
Mscv Cas9 Puro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mscv+cas9+puro+plasmid/MSCV_Cas9_puro+(Plasmid+%2365655)/10__1038_slash_s41375___026___02917___2-243-0-2
Average 94 stars, based on 23 article reviews
mscv cas9 puro plasmid - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: A Perturb-seq map of a differentiation hub reveals synergistic vulnerabilities in KMT2A-rearranged acute myeloid leukemia Article Snippet: .. Article Title: TCF-1 promotes chromatin interactions across topologically associating domains in T cell progenitors Article Snippet: Cells which have been transduced with the same vector but have not been treated with doxycycline are referred to as ‘untreated NIH-3T3’ while doxycycline-treated cells are referred to as ‘TCF-1 induced NIH-3T3’. . Retroviral Packaging and Transduction for TCF-1 KO in Scid.adh cell line CRISPR/Cas9 system was used to delete TCF-1 in Scid.adh cells. sgRNAs targeting the DNA-binding domain (HMG-box) were designed using CRISPR Targets tracks of UCSC genome browser. .. ACCGCAACCAGATCCTGGGTCGCA and AAACTGCGACCCAGGATCTGGTTG were used as sgRNA. sgRNA was cloned into pSL21-vex (Addgene 158230) 69 , Article Title: Modeling the t(2;5) Translocation of Anaplastic Large Cell Lymphoma Using CRISPR-Mediated Chromosomal Engineering Article Snippet: The MSCV-MCS-PGK-Puro-IRES-GFP plasmid was a gift from Christopher Vakoc (Addgene plasmid # 75,124) [ ]. .. The Article Title: Modeling the t(2;5) Translocation of Anaplastic Large Cell Lymphoma Using CRISPR-Mediated Chromosomal Engineering. Article Snippet: The MSCV-MCS-PGK-Puro-IRES-GFP plasmid was a gift from Christopher Vakoc (Addgene plasmid # 75,124) [21]. .. The Expressing:Article Title: A Perturb-seq map of a differentiation hub reveals synergistic vulnerabilities in KMT2A-rearranged acute myeloid leukemia Article Snippet: .. Clone Assay:Article Title: TCF-1 promotes chromatin interactions across topologically associating domains in T cell progenitors Article Snippet: Cells which have been transduced with the same vector but have not been treated with doxycycline are referred to as ‘untreated NIH-3T3’ while doxycycline-treated cells are referred to as ‘TCF-1 induced NIH-3T3’. . Retroviral Packaging and Transduction for TCF-1 KO in Scid.adh cell line CRISPR/Cas9 system was used to delete TCF-1 in Scid.adh cells. sgRNAs targeting the DNA-binding domain (HMG-box) were designed using CRISPR Targets tracks of UCSC genome browser. .. ACCGCAACCAGATCCTGGGTCGCA and AAACTGCGACCCAGGATCTGGTTG were used as sgRNA. sgRNA was cloned into pSL21-vex (Addgene 158230) 69 , Retroviral:Article Title: TCF-1 promotes chromatin interactions across topologically associating domains in T cell progenitors Article Snippet: Cells which have been transduced with the same vector but have not been treated with doxycycline are referred to as ‘untreated NIH-3T3’ while doxycycline-treated cells are referred to as ‘TCF-1 induced NIH-3T3’. . Retroviral Packaging and Transduction for TCF-1 KO in Scid.adh cell line CRISPR/Cas9 system was used to delete TCF-1 in Scid.adh cells. sgRNAs targeting the DNA-binding domain (HMG-box) were designed using CRISPR Targets tracks of UCSC genome browser. .. ACCGCAACCAGATCCTGGGTCGCA and AAACTGCGACCCAGGATCTGGTTG were used as sgRNA. sgRNA was cloned into pSL21-vex (Addgene 158230) 69 , |